Meet Singles From Detroit
100% FREE Detroit chat rooms at Mingle2.com. Join the hottest Detroit chatrooms online! Mingle2's Detroit chat rooms are full of fun, sexy singles like you. Sign up for your free Detroit chat account now and meet hundreds of Michigan singles online! No other Detroit chat sites compare!
Mingle2 is 100% FREE! Put away your credit card, you'll never pay a cent to use this site.
Detroit Chat
Ann Arbor Chat Site
: 
: 35 year old man
"Miner for a heart of gold"
dashingly handsome
utterly irresistible
worth waiting for
I will let my DNA code describe the rest:
ATCGTGTCGATCGATGCTAGCTGGCCCAACGATTTTCAAACTATGGAGTGATGCGTAGTC ...
Free Cleveland Chatrooms
:
: 25 year old man
"Lookin for a fun girl...."
I'm just looking for a sporty girl who can show me a good time and keep my attention....
Chat Online in Columbiaville
:
: 26 year old man
"still searching"
recently home from florida and didnt grow up in the area and lookin to meet someone to hang out with in hopes for a relationship,
Free Wayne Chat
:
: 61 year old woman
"Looking For My Shineing Star"
I am a Virgo I do not Smoke or Drink I am very postive person and very Pvt.My life style
Is Traveling.. shop around, very passion with feelings very patience, loyal I've a beautiful smile very ...
Free Brunswick Chat
:
: 26 year old man
"looking for friends"
I am looking for friends. I have found someone and am waiting to see where it goes. Can never have to many friends so if you would like to talk send me a message.
Chat Online in Fenton
:
: 40 year old woman
"looking for someone to dream with "
I am A single mom to A beautiful son, I work but also I do like to be adventureous the only problem is I have no one to do it with I am A great person yes I am alittle chunk but I do wear my weight...
Milan Chat
:
: 28 year old woman
"Just the girl next door"
I am a Assistant General Manager, a part time mechanic, a part time student and a full time mother. I love to go camping, fishing, bowling, shoot pool, kick back a few beers, sit at home and watch a...
Free Cleveland Chatrooms
:
: 43 year old man
"i do as i please and i do it with ease."
I like Mexico, anything that involves a boat,including drinking,(not to sound like a drunk)-(oh **** it! i am a drunk) i am really in to drama,games, getting abused by any girl that i am interested...
W Chat Sites
:
: 23 year old man
"Do you like local band shows?"
I'm a go with the flow type of guy. When change in my life is imminent, I smile and bear it. I always formulate the positive of a situation.
If there were an optimal thread in this life that helps...
Detroit Gay Personals |
Detroit Lesbian Personals |
Detroit Jewish Singles
Detroit Asian Dating |
Detroit Senior Dating |
Detroit Single Parents
Other Michigan Cities:
- Ann Arbor Chat Rooms
- Battle Creek Chat Rooms
- Bay City Chat Rooms
- Brownstown Chat Rooms
- Canton Chat Rooms
- Clinton Township Chat Rooms
- Dearborn Chat Rooms
- Dearborn Heights Chat Rooms
- Detroit Chat Rooms
- East Lansing Chat Rooms